AnimaliaNot EvaluatedacceptedspeciesAccepted
Scapholeberis duranguensis

Scapholeberis duranguensis

GBIF:119624324

ABOUT

Descriptions(7)

Description. Head large, (slightly less than a third of the total length), bilaterally ridged, reticulated and with a pore-like structure at the top (Figure 1 A), not visible in all studied specimens. Well-developed and rounded rostrum with a pore that opens near its tip (Figure 3 D). This pore is present in majority of anomopods (Kotov 1996) and is called rostral or frontal pore. Globular eye and elongated ocellus. Antennule short and rectangular with eight terminal aesthetascs cylindrical and similar in length (Figure 3 C). There is a thinner lateral sensory seta similar in size to the aesthetascs. Antenna with four-segmented exopod and three-segmented endopod (Figure 3 F). First exopod segment relatively short (approx. one third of the second segment). Second segment slightly shorter than the next and with a spine at distal margin. Last two segments of similar size. First endopod segment slightly longer than the other two. First and second endopod segments with a long internal-lateral seta. Three long setae at each apical segment of the endopod and exopod. Postabdomen robust, rectangular and with ventral margin slightly curved (Figure 2 G, 3 G). The total length is approximately three times the height. Preanal portion approximately one third of the total length. Ventral face with two lateral rows of five spines, similar in size. Following the last spine there are two bunches of mid length cilia. Postabdominal claw slightly shorter than the preanal portion (Figure 2 G, H and 3 G). With three pectens (rows of spinules) at each side. The external pecten has only four spines gradually increasing in size. The medium pecten starts at the base of the claw and extends to a bit less than half of it. The internal one starts at the last third of the mid pecten and extends to the tip of the claw. Mandible with rectangular distal end (Figure 3 B) and the basal third of body incurved. Masticatory surface with a row of about seven thick and short teeth. Trunk limb I (P 1). Exopod with two not-segmented, apical setae, the first one half as long as the second one (Figure 4 A). Distal two thirds of both setae with two rows of long and thick cilia in the ventral face. Transversal row of cilia in the middle of both setae. Endopod with three apical setae. The longest seta with very short cilia bilaterally arranged in more than half of its total length. The second seta two thirds as long as the first one and with an apical tuft of long and thick cilia. The third seta is brush-shaped and slightly shorter than the previous one. Endite 1 with four setae, endites 2 and 3 with two setae each. All setae on endites are similar in length, shape and cilia arrangement. The base of such setae, which represents approximately a third of the total length, is wider than the apical part and has a bilateral arrangement of long and fine cilia. The apical part has two rows of medium-sized thick cilia in the ventral face. All endites with an accessory seta similar in structure to the ejector hooks but slightly shorter. Long ejector hooks with apical arrangement of cilia are just below the base of endite 1. Accessory seta at the external face of base of limb body. Trunk limb II (P 2). Exopod with two apical feather-like setae, the first one is twice as long as the second one (Figure 4 B). Endopod with five apical setae similar in size. Setae 2 - 5 serrated from base to tip and the first one (1) is feather-like with a bilateral arrangement of long and thin cilia from base to tip. Additionally there is a thin and feathered seta that arises from the base of the fifth seta. Near this setae there is also a pair of appendages that arise from the base of the exopod, one of them apical and with ventral short cilia in the distal two thirds, the second one is a naked structure, half as long as the previous one and with a rounded tip. Gnathobase with eight setae (Fig 4 C). The longest one has two ventral rows of long cilia that extend from base to tip. The second seta is finger-like and it is approximately two thirds as long as the first one. It is a naked seta but it has two ventral rows of thick spine-like structures in the upper half. The third seta is apical, slightly shorter than the previous one and with a transversal row of thick and long cilia in the middle and with two ventral rows of short and thick cilia from the mid part to the tip. The remaining five setae are similar in shape and cilia arrangement to the previous one and with a gradual increase in length. Trunk limb III (P 3). Exopod with four apical and two lateral feathered setae (Figure 4 E). The two lateral setae are of mid length and bilaterally covered with thin and long cilia from base to tip, the second of such pair of setae is about half as long as the first one. The first two apical setae (1 and 2) are similar in shape and cilia arrangement to the lateral ones but thinner and longer. The second seta slightly shorter than the first one. Setae 3 and 4 with the lower third covered with long and thin cilia and the upper two thirds with very short and fine cilia. Gnathobase with numerous (about 24) long, bisegmented and thin setae similar in shape and size. All setae with a bilateral arrangement of very short and thin cilia from base to tip. Last distal setae are more internally placed than the others. There are four endites, each with at least 2 ciliated setae, between the exopodite and the gnathobase. Trunk limb IV (P 4). Exopod with four apical and two lateral setae. The two lateral setae are of mid length and bilaterally covered with thin and long cilia from base to tip, the second of such pair of setae is longer than the first one (Figure 4 F). The first three apical setae (1 to 3) are similar in shape and cilia arrangement to the lateral ones but thinner and longer and show a decrease in length. Seta 4 different in shape from the others. It has a wider and well defined base which is slightly less than half of the total length. Such a base is laterally covered with long cilia and with shorter cilia in the upper ring. The upper portion of the seta is narrower and without cilia. Gnathobase with two rows of setae (one external and one internal), similar in shape to those of P 3 ’ s gnathobase. The external set has ten setae while the internal one has five. There is an endite between the gnathobase and the exopod. Trunk limb V (P 5). Endopod with a long, bisegmented and densely ciliated seta (Figure 4 G). A finger-like structure at the base of this seta is approximately half as long as the base portion of such a seta. Exopod with two shorter ciliated setae. The first one bisegmented and a third longer than the second one. There is a long feather-like proximal setae at the base of the exopod. Differential diagnosis: The main morphological characters that differentiate S. duranguensis n. sp. from S. armata freyi are: (1) a double and thicker membrane at the posterior rim of valves, (2) lower number (8 compared to 9) of setae in the gnathobase of trunk limb II (see Figures 4 C and D), (3) longer and more rectilinear ejector hooks on trunk limb I, and (4) the presence of a pore-like structure at the top of the head (not a definitive character). The average length of the mucro in proportion to the length of the valves in S. duranguensis (1 / 5) is significantly higher (p <0.001, n = 8) than in S. armata freyi (1 / 7). The size of the adult specimens (females) is also significantly different (p <0.01, n = 20) between the two species. The average length for 20 individuals of S. armata freyi is 0.45 mm ± 0.05 mm whereas in S. duranguensis it is 0.6 mm ± 0.09 mm. The main differences between S. duranguensis n. sp. and S. armata armata were the lack of a hyaline membrane and a thinner membrane at the posterior rim of the valves in the latter, as well as the average size of the organisms. S. armata armata is noticeably larger (0.82 mm, n = 7) than S. duranguensis n. sp. The relative length of the mucro in S. armata armata is significantly lower (1 / 7) than in S. duranguensis n. sp (1 / 5). Differences of our new species from other species include the arrangement of the denticulate membrane at the posterior rim of the valves, an important feature for taxonomic discrimination according to Dumont and Pensaert (1983).
Quiroz-Vázquez, Patricia, Elías-Gutiérrez, Manuel (2009): A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding. Zootaxa 2236: 50-64, DOI: 10.5281/zenodo.190439
ZPLMX 096 - 06: AATCCGAGCAGAATTAGGTCAAGCTGGAAGTTTAATTGGGGATGATCAGATTTATAATGT: 120 ZPLMX 144 - 06: ... T ........ G ........ G ..... G .. C ........ A ........ A ........ C ..: 120 * 140 * 160 * 180 ZPLMX 096 - 06: AGTTGTTACAGCCCACGCGTTTGTCATAATTTTCTTTATAGTTATACCAATCATGATTGG: 180 ZPLMX 144 - 06:. A. C ........... T ........ G ..... C .. T ..........................: 180 * 200 * 220 * 240 ZPLMX 096 - 06: GGGGTTCGGTAATTGATTAGTTCCTCTAATGTTAGGCGCCCCTGACATAGCTTTTCCGCG: 240 ZPLMX 144 - 06: ... C .. T ......... C .... C ......... C .... T ........ T ........... T ..: 240 * 260 * 280 * 300 ZPLMX 096 - 06: ATTAAATAACTTAAGTTTTTGGTTTCTTCCCCCCGCTTTAACTTTACTTTTAGTTGGAGG: 300 ZPLMX 144 - 06: .......... C ....... C ........... T .. T .................... A .. G ..: 300 * 320 * 340 * 360 ZPLMX 096 - 06: GGCGGTAGAAAGTGGGGCTGGAACTGGGTGAACCGTTTACCCGCCCTTGTCAGCAGGAAT: 360 ZPLMX 144 - 06: ... T ........... A .................... C ..... T ..... A ........ G ..: 360 * 380 * 400 * 420 ZPLMX 096 - 06: TGCTCACGCCGGAGCATCAGTTGATCTAAGAATTTTCTCTCTTCACTTAGCAGGGATTTC: 420 ZPLMX 144 - 06: ... C .. T .. T .............. C ........... T .. C ........ G ...........: 420 * 440 * 460 * 480 ZPLMX 096 - 06: TTCTATTTTAGGGGCTGTTAATTTTATTACTACTATCATTAATATACGATCGGAGGGAAT: 480 ZPLMX 144 - 06: .......................................... C ........ A .. A .. G ..: 480 * 500 * 520 * 540 ZPLMX 096 - 06: GTCTTTAGACCGAATTCCGTTATTTGTATGAGCAGTGGGAATTACAGCTCTTCTTTTACT: 540 ZPLMX 144 - 06: ... C ..... T ........... G ........ G ..... A .. G .. C ........ C ........: 540 * 560 * 580 * 600 ZPLMX 096 - 06: TTTAAGTCTTCCCGTGCTAGCTGGTGCAATCACAATGCTTCTTACAGATCGAAATTTAAA: 600 ZPLMX 144 - 06: ............... A ................. G ..... CT. A .................: 600 * 620 * 640 * ZPLMX 096 - 06: TACTTCGTTTTTTGACCCTGCTGGGGGAGGAGATCCTATTCTTTACCAGCATCTTTTC: 658 ZPLMX 144 - 06: ............ C ................. G .. C .. A ... T .... T .. A .........: 658 Figure 5 shows the ID tree of the several Scapholeberis used for comparison in this study (see Table 2). Main variation in the sequences of S. duranguensis was in the GC % of the first codon position, in which such a percentage varied from 27.4 to 29.5. In S. armata freyi, the main variation was in the GC % of the third codon position, in which it was from 25.5 to 27. The main total variation in both species was given by the C %. In S. duranguensis this percentage varied from 18.8 to 20.5 whereas in S. armata freyi it varied from 18.24 to 19.55.
Quiroz-Vázquez, Patricia, Elías-Gutiérrez, Manuel (2009): A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding. Zootaxa 2236: 50-64, DOI: 10.5281/zenodo.190439
Diagnosis. Medium-sized daphniids. Parthenogenetic females around 0.6 (0.59 ± 0.09) mm, body ovoid (height / length = 0.55 - 0 - 69, n = 20). Large and bilaterally ridged head with a pore-like structure at the top (Figure 1 A and B). Well-developed and rounded rostrum (Figure 3 D) with the so-called rostral pore. Ventral rim of valves infolded, supplied with cilia that ramify to form an adhesive sucker-plate (Figure 3 A). Ventroposterior corner of valves angular, forming a well-defined mucro of medium length (Figures 1 D and 3 A). Posterior rim of valves with a thick double membrane. Upper membrane denticulate (Figure 1 G, H). Both, the head and the valves with fine reticulation (Figure 1 A, D). Postabdomen robust, rectangular and with ventral margin slightly curved (Figure 3 G). Postabdomen claw with three successive bilateral pectens of different size. Antennule short, with eight terminal esthetascs and a lateral sensory seta. Antenna short, with a foursegmented exopod and a three-segmented endopod. Five trunk limbs of general daphnid shape. Endopodite of trunk limb I with a brush-like seta. Ephippium with a single egg.
Quiroz-Vázquez, Patricia, Elías-Gutiérrez, Manuel (2009): A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding. Zootaxa 2236: 50-64, DOI: 10.5281/zenodo.190439
Distribution: S. duranguensis n. sp. is known only from its type locality. Molecular Sequences (CO 1): Sequences of the gene CO 1 used for barcoding by the BOLD (www. boldsystems. org) informatics data base were obtained from three topotypes of the new species. All of them are published in the project " Cladocera of Mexico " in BOLD. The average divergence between the three sequences was 0.54 ± 0.03 %, with a maximum of 0.61 %. Average divergence between the three specimens of S. armata freyi used for comparison was 0.35 ± 0.06 %, with a maximum of 0.62 %. Below are the differences in the nucleotide composition of the COI sequence between S. armata freyi (ZPLMX 096 - 06) and S. duranguensis n. sp. (ZPLMX 144 - 06). * 20 * 40 * 60 ZPLMX 096 - 06: GACATTATATTTTATTTTTGGAGTCTGATCTGGTATAGTAGGAACTGCTTTAAGAATGTT: 60 ZPLMX 144 - 06: ..................... G .. A ...................................: 60 * 80 * 100 * 120
Quiroz-Vázquez, Patricia, Elías-Gutiérrez, Manuel (2009): A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding. Zootaxa 2236: 50-64, DOI: 10.5281/zenodo.190439
Etymology: This species is named after its terra typica, Durango State, Mexico.
Quiroz-Vázquez, Patricia, Elías-Gutiérrez, Manuel (2009): A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding. Zootaxa 2236: 50-64, DOI: 10.5281/zenodo.190439
Holotype: Adult ephippial female in 96 % ethanol with addition of a drop of glycerol. Total length 0.64 mm, height 0.44 mm. Access number, ECO-CH-Z 0 3831. Paratypes: Two ephippial females (one dissected) mounted in Hoyer´s solution, sealed with Enthellan mounting medium (ECO-CH-Z 0 3835, 03839). One ephippial female preserved in 96 % ethanol and glycerol (ECO-CH-Z 03841), one parthenogenetic female in 96 % ethanol and glycerol (ECO-CH-Z 03832). Five parthenogenetic females, (one dissected) mounted as above (ECO-CH-Z 0 3833, 0 3834, 03836 - 03838). In addition, two parthenogenetic females preserved in 96 % ethanol and glycerol, and one ephippial female preserved as above (CNCR 25880) deposited at Instituto de Biología (Universidad Nacional Autónoma de México, UNAM).
Quiroz-Vázquez, Patricia, Elías-Gutiérrez, Manuel (2009): A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding. Zootaxa 2236: 50-64, DOI: 10.5281/zenodo.190439
Type Locality: El Chupadero is a small and shallow temporal pond located at 24 º 08 ’ 09.1 ’’ N and 104 º 42 ’ 43.2 ’’ W in the south semi-desert region of Durango State, Mexico. At the time of sampling the pond had a total depth of 0.5 m, temperature of 17.8 ºC, pH of 7.8, conductivity of 0.264 mS / Cm and a Secchi depth of 0.4 m.
Quiroz-Vázquez, Patricia, Elías-Gutiérrez, Manuel (2009): A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding. Zootaxa 2236: 50-64, DOI: 10.5281/zenodo.190439

Export occurrence data

Darwin Core Archive (ZIP)

CLASSIFICATION

Taxonomic Classification Tree

MULTIMEDIA

Media Files(5)

FIGURE 1. SEM photographs: A, B, D, G and H Scapholeberis duranguensis n. sp., parthenogenetic female. A. Anterior view of the head and rostrum (note the keels on the head, the reticulated rostrum and the pore at the top of the head); B. Head pore; D. Habitus; G and H. Posterior rim of valves (note the thick double membrane of which the upper one is denticulated); C, E, F, I, J, K and L Scapholeberis armata freyi, parthenogenetic female. C. Anterior view of the head and rostrum (note that there is not a pore-like structure at the top of the head); E and F. Lateral view of a cultured and a wild specimen, respectively, both parthenogenetic females; I to L. Posterior rim of the valves with denticulate membrane (note that the membrane is thinner than in S. duranguensis n. sp.)

Imageimage/png© Quiroz-Vázquez, Patricia;Elías-Gutiérrez, ManuelQuiroz-Vázquez, Patricia;Elías-Gutiérrez, Manuel

FIGURE 2. SEM photographs: A, C, E and G Scapholeberis duranguensis n. sp. A. Ephippial female, lateral view; C. Ventral view of trunk limbs; E. Ejector hooks (note the length as compared to those of S. armata freyi); G. Postabdomen and postabdominal claw. B, D, F and H Scapholeberis armata freyi, ephippial female. B. Lateral view; D. Ventral view of trunk limbs; F. Ejector hooks; H. Postabdomen and postabdominal claw.

Imageimage/png© Quiroz-Vázquez, Patricia;Elías-Gutiérrez, ManuelQuiroz-Vázquez, Patricia;Elías-Gutiérrez, Manuel

FIGURE 3. S. duranguensis n. sp. A. Lateral view of ephippial female; B. Mandible; C. Antennule; D. Anterior view of the head; E. Upper view of the head; F. Antenna; G. Postabdomen and postabdominal claw.

Imageimage/png© Quiroz-Vázquez, Patricia;Elías-Gutiérrez, ManuelQuiroz-Vázquez, Patricia;Elías-Gutiérrez, Manuel

FIGURE 4. S. duranguensis n. sp. A. trunk limb I; B. trunk limb II; C. Gnathobase of trunk limb II; D. Gnathobase of trunk limb II of S. armata freyi for comparison; E. Trunk limb III; F. trunk limb IV. G. Trunk limb V. Initials: AS = Accessory Seta, EH = ejector hooks, EN = endopod, EX = exopod, PS = proximal seta, E = endite, GN = gnathobase, BS = brush-shaped setae

Imageimage/png© Quiroz-Vázquez, Patricia;Elías-Gutiérrez, ManuelQuiroz-Vázquez, Patricia;Elías-Gutiérrez, Manuel

FIGURE 5. ID tree based in maximum likelihood analyses in PAUP (– lnL = 2482.38). Other Scapholeberis are used for comparison purposes with our material. To identify each Scapholeberis sp., GenBank accession numbers are provided.

Imageimage/png© Quiroz-Vázquez, Patricia;Elías-Gutiérrez, ManuelQuiroz-Vázquez, Patricia;Elías-Gutiérrez, Manuel

IMAGES

Gallery(5)

See Gallery

Occurrences with images

Source Information

A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding

checklist

This dataset contains the digitized treatments in Plazi based on the original journal article Quiroz-Vázquez, Patricia, Elías-Gutiérrez, Manuel (2009): A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding. Zootaxa 2236: 50-64, DOI: 10.5281/zenodo.190439

Abstract

Sequencing of the CO1 mitochondrial gene (barcoding) highlighted a possible different species in the semi-desert region of Mexico. After a detailed morphological analysis we describe Scapholeberis duranguensis n. sp. (Cladocera: Anomopoda: Daphniidae). Specimens from the type locality, El Chupadero, Durango, were compared with specimens of S. armata armata Herrick, 1882 and S. armata freyi Dumont and Pensaert, 1983 from Canada and southeastern, central and northern Mexico. The main characters that differentiate the new species are: (1) a thicker denticulate membrane with a conspicuous underlying hyaline membrane at the posterior rim of the valves, (2) fewer setae in the gnathobase of trunk limb II and (3) longer and more rectilinear ejector hooks in trunk limb I. The presence of a pore-like structure at the top of the head was also observed, however we are not certain whether this can be considered as a distinctive character, as it was not consistent in all SEM scanned organisms. The denticulate membrane, the number of setae in the gnathobase of trunk limb II and the length of the ejector hooks are characters shared with other species, however, the combination of them and in particular the structure and thickness of the double membrane at the posterior rim of the valves lead us to conclude that S. duranguensis is a species different from S. armata and from other members of this genus. The CO1 sequences of S. armata freyi and S. duranguensis n. sp. showed a mean divergence of 12.02%, thus supporting the morphological differences between them. Finally, a comparison of the CO1 sequences of Scapholeberis duranguensis n.sp. with other Scapholeberinae available in GenBank supported our results.

Key words: Branchiopoda, Cladocera, Daphniidae, barcodes, taxonomy, new species, systematics, North America

Quiroz-Vázquez P, Elías-Gutiérrez M, plazi (2009). A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding. Plazi.org taxonomic treatments database. Checklist dataset https://doi.org/10.5281/zenodo.190439 accessed via GBIF.org on 2026-06-18.

CC0Published 12/31/2009View dataset
GBIF Usage Key
119624324
Dataset Key
03616bb7-53de-42e1-ae7a-87557c1717c3
Origin
source
Backbone Key
8242118
Taxon ID
03A487C6FFC2A656FF65FC75028BEDAD.taxon
Last Crawled
6/11/2026
Last Interpreted
6/11/2026